ID: 1063725760

View in Genome Browser
Species Human (GRCh38)
Location 10:8635694-8635716
Sequence GATACACTTATATATCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063725756_1063725760 -3 Left 1063725756 10:8635674-8635696 CCCGCCTCCTATTGGGGTGGGAT No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data
1063725757_1063725760 -4 Left 1063725757 10:8635675-8635697 CCGCCTCCTATTGGGGTGGGATA No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data
1063725749_1063725760 7 Left 1063725749 10:8635664-8635686 CCAACTTAGCCCCGCCTCCTATT No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data
1063725755_1063725760 -2 Left 1063725755 10:8635673-8635695 CCCCGCCTCCTATTGGGGTGGGA No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data
1063725759_1063725760 -10 Left 1063725759 10:8635681-8635703 CCTATTGGGGTGGGATACACTTA No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data
1063725758_1063725760 -7 Left 1063725758 10:8635678-8635700 CCTCCTATTGGGGTGGGATACAC No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063725760 Original CRISPR GATACACTTATATATCTTTC AGG Intergenic
No off target data available for this crispr