ID: 1063727693

View in Genome Browser
Species Human (GRCh38)
Location 10:8656457-8656479
Sequence ACGTGTGTCATTCACTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063727689_1063727693 28 Left 1063727689 10:8656406-8656428 CCATTTTTTTCCGGTCAGAGGGC No data
Right 1063727693 10:8656457-8656479 ACGTGTGTCATTCACTAGACTGG No data
1063727687_1063727693 29 Left 1063727687 10:8656405-8656427 CCCATTTTTTTCCGGTCAGAGGG No data
Right 1063727693 10:8656457-8656479 ACGTGTGTCATTCACTAGACTGG No data
1063727690_1063727693 18 Left 1063727690 10:8656416-8656438 CCGGTCAGAGGGCTTATCTCATT No data
Right 1063727693 10:8656457-8656479 ACGTGTGTCATTCACTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063727693 Original CRISPR ACGTGTGTCATTCACTAGAC TGG Intergenic
No off target data available for this crispr