ID: 1063731079

View in Genome Browser
Species Human (GRCh38)
Location 10:8697913-8697935
Sequence CACTTAACCCCGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063731079_1063731085 8 Left 1063731079 10:8697913-8697935 CCTCCGCCTCCCGGGGTTAAGTG No data
Right 1063731085 10:8697944-8697966 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1063731079_1063731089 17 Left 1063731079 10:8697913-8697935 CCTCCGCCTCCCGGGGTTAAGTG No data
Right 1063731089 10:8697953-8697975 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1063731079_1063731087 9 Left 1063731079 10:8697913-8697935 CCTCCGCCTCCCGGGGTTAAGTG No data
Right 1063731087 10:8697945-8697967 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063731079 Original CRISPR CACTTAACCCCGGGAGGCGG AGG (reversed) Intergenic
No off target data available for this crispr