ID: 1063734683

View in Genome Browser
Species Human (GRCh38)
Location 10:8739692-8739714
Sequence CAAGTTACTCCCATTGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063734674_1063734683 16 Left 1063734674 10:8739653-8739675 CCCTCTCATGTATCCCCCTAACC No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734680_1063734683 -5 Left 1063734680 10:8739674-8739696 CCAGCCTGTCTGCAGCTCCAAGT No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734681_1063734683 -9 Left 1063734681 10:8739678-8739700 CCTGTCTGCAGCTCCAAGTTACT No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734679_1063734683 0 Left 1063734679 10:8739669-8739691 CCTAACCAGCCTGTCTGCAGCTC No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734678_1063734683 1 Left 1063734678 10:8739668-8739690 CCCTAACCAGCCTGTCTGCAGCT No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734676_1063734683 3 Left 1063734676 10:8739666-8739688 CCCCCTAACCAGCCTGTCTGCAG No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734677_1063734683 2 Left 1063734677 10:8739667-8739689 CCCCTAACCAGCCTGTCTGCAGC No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734673_1063734683 25 Left 1063734673 10:8739644-8739666 CCTATACTACCCTCTCATGTATC No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data
1063734675_1063734683 15 Left 1063734675 10:8739654-8739676 CCTCTCATGTATCCCCCTAACCA No data
Right 1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063734683 Original CRISPR CAAGTTACTCCCATTGAAGT TGG Intergenic
No off target data available for this crispr