ID: 1063740777

View in Genome Browser
Species Human (GRCh38)
Location 10:8816621-8816643
Sequence TTGGTTCTCTATCCATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063740777_1063740780 -7 Left 1063740777 10:8816621-8816643 CCTCCCAATGGATAGAGAACCAA No data
Right 1063740780 10:8816637-8816659 GAACCAATGTCACCACATCAAGG No data
1063740777_1063740783 23 Left 1063740777 10:8816621-8816643 CCTCCCAATGGATAGAGAACCAA No data
Right 1063740783 10:8816667-8816689 TCATACTGTGTTCCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063740777 Original CRISPR TTGGTTCTCTATCCATTGGG AGG (reversed) Intergenic
No off target data available for this crispr