ID: 1063751701

View in Genome Browser
Species Human (GRCh38)
Location 10:8956259-8956281
Sequence GTAAAAAGAAGGCTGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063751698_1063751701 9 Left 1063751698 10:8956227-8956249 CCTTTGCAAAACTCTGTTAATAT No data
Right 1063751701 10:8956259-8956281 GTAAAAAGAAGGCTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063751701 Original CRISPR GTAAAAAGAAGGCTGCTGTG AGG Intergenic
No off target data available for this crispr