ID: 1063752552

View in Genome Browser
Species Human (GRCh38)
Location 10:8967267-8967289
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063752552_1063752555 12 Left 1063752552 10:8967267-8967289 CCAGGCTACAGTTCTACTTGCAT No data
Right 1063752555 10:8967302-8967324 CAGCTCACCATGAATGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063752552 Original CRISPR ATGCAAGTAGAACTGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr