ID: 1063768275

View in Genome Browser
Species Human (GRCh38)
Location 10:9168288-9168310
Sequence AGATTTTTACTGATAGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063768269_1063768275 9 Left 1063768269 10:9168256-9168278 CCCCATGTATATAAGGTATCTGT No data
Right 1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG No data
1063768270_1063768275 8 Left 1063768270 10:9168257-9168279 CCCATGTATATAAGGTATCTGTG No data
Right 1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG No data
1063768271_1063768275 7 Left 1063768271 10:9168258-9168280 CCATGTATATAAGGTATCTGTGG No data
Right 1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063768275 Original CRISPR AGATTTTTACTGATAGTTCA AGG Intergenic
No off target data available for this crispr