ID: 1063771810

View in Genome Browser
Species Human (GRCh38)
Location 10:9212278-9212300
Sequence CGGTATGTGGAGTCAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063771810_1063771817 10 Left 1063771810 10:9212278-9212300 CCATCCATTGACTCCACATACCG No data
Right 1063771817 10:9212311-9212333 ATGCCAAAGTCCACAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063771810 Original CRISPR CGGTATGTGGAGTCAATGGA TGG (reversed) Intergenic
No off target data available for this crispr