ID: 1063775961

View in Genome Browser
Species Human (GRCh38)
Location 10:9264439-9264461
Sequence CTACATCACTAGAGGAAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063775956_1063775961 -10 Left 1063775956 10:9264426-9264448 CCCCAAATTTTAGCTACATCACT No data
Right 1063775961 10:9264439-9264461 CTACATCACTAGAGGAAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063775961 Original CRISPR CTACATCACTAGAGGAAGGT CGG Intergenic
No off target data available for this crispr