ID: 1063791227

View in Genome Browser
Species Human (GRCh38)
Location 10:9450280-9450302
Sequence GTTTCACAGTTCCATGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063791227_1063791230 8 Left 1063791227 10:9450280-9450302 CCAGTCACATGGAACTGTGAAAC No data
Right 1063791230 10:9450311-9450333 TTTGTAAATTGCCCAGTCTTGGG 0: 669
1: 2285
2: 5340
3: 12814
4: 14384
1063791227_1063791229 7 Left 1063791227 10:9450280-9450302 CCAGTCACATGGAACTGTGAAAC No data
Right 1063791229 10:9450310-9450332 TTTTGTAAATTGCCCAGTCTTGG 0: 1023
1: 1194
2: 1169
3: 4779
4: 5078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063791227 Original CRISPR GTTTCACAGTTCCATGTGAC TGG (reversed) Intergenic
No off target data available for this crispr