ID: 1063791331

View in Genome Browser
Species Human (GRCh38)
Location 10:9451554-9451576
Sequence AACCGTGTGCTGAAACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063791328_1063791331 -2 Left 1063791328 10:9451533-9451555 CCTTTCCCTGGCACGCAGGCTAA No data
Right 1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG No data
1063791324_1063791331 26 Left 1063791324 10:9451505-9451527 CCATTGCATTTAAAATGAAATCC No data
Right 1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG No data
1063791330_1063791331 -8 Left 1063791330 10:9451539-9451561 CCTGGCACGCAGGCTAACCGTGT No data
Right 1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG No data
1063791329_1063791331 -7 Left 1063791329 10:9451538-9451560 CCCTGGCACGCAGGCTAACCGTG No data
Right 1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG No data
1063791326_1063791331 5 Left 1063791326 10:9451526-9451548 CCACTCTCCTTTCCCTGGCACGC No data
Right 1063791331 10:9451554-9451576 AACCGTGTGCTGAAACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063791331 Original CRISPR AACCGTGTGCTGAAACTTGC TGG Intergenic
No off target data available for this crispr