ID: 1063794509

View in Genome Browser
Species Human (GRCh38)
Location 10:9496943-9496965
Sequence CTGTTGGGATTGGGTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063794503_1063794509 -5 Left 1063794503 10:9496925-9496947 CCACAATTCCTGAGATGACTGTT No data
Right 1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG No data
1063794502_1063794509 12 Left 1063794502 10:9496908-9496930 CCTTTCTGAAAGAAGGTCCACAA No data
Right 1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063794509 Original CRISPR CTGTTGGGATTGGGTAAAAA TGG Intergenic
No off target data available for this crispr