ID: 1063796371

View in Genome Browser
Species Human (GRCh38)
Location 10:9517706-9517728
Sequence TCGCCCTTCCCAGTGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063796371_1063796376 9 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796376 10:9517738-9517760 GCAATTCTTGGGAAATTGGCTGG No data
1063796371_1063796374 -2 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796374 10:9517727-9517749 GAATTACTGTTGCAATTCTTGGG No data
1063796371_1063796373 -3 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796373 10:9517726-9517748 CGAATTACTGTTGCAATTCTTGG No data
1063796371_1063796378 30 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796378 10:9517759-9517781 GGGTCATCTGTACAACTTACTGG No data
1063796371_1063796377 10 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796377 10:9517739-9517761 CAATTCTTGGGAAATTGGCTGGG No data
1063796371_1063796375 5 Left 1063796371 10:9517706-9517728 CCAGGGGCCACTGGGAAGGGCGA No data
Right 1063796375 10:9517734-9517756 TGTTGCAATTCTTGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063796371 Original CRISPR TCGCCCTTCCCAGTGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr