ID: 1063797482

View in Genome Browser
Species Human (GRCh38)
Location 10:9528924-9528946
Sequence AGCGCAACAGTTTTATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063797482_1063797488 8 Left 1063797482 10:9528924-9528946 CCACCTCATAAAACTGTTGCGCT No data
Right 1063797488 10:9528955-9528977 AATTTCAACATGAATTTTGGAGG 0: 66
1: 552
2: 1560
3: 2893
4: 3488
1063797482_1063797487 5 Left 1063797482 10:9528924-9528946 CCACCTCATAAAACTGTTGCGCT No data
Right 1063797487 10:9528952-9528974 TTAAATTTCAACATGAATTTTGG 0: 75
1: 555
2: 1317
3: 2761
4: 6480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063797482 Original CRISPR AGCGCAACAGTTTTATGAGG TGG (reversed) Intergenic
No off target data available for this crispr