ID: 1063803893

View in Genome Browser
Species Human (GRCh38)
Location 10:9615292-9615314
Sequence CAGTATCCCTGAGCCCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063803888_1063803893 2 Left 1063803888 10:9615267-9615289 CCTCGACTGAGAATACTACAGTC No data
Right 1063803893 10:9615292-9615314 CAGTATCCCTGAGCCCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063803893 Original CRISPR CAGTATCCCTGAGCCCTAGG GGG Intergenic
No off target data available for this crispr