ID: 1063804452

View in Genome Browser
Species Human (GRCh38)
Location 10:9622725-9622747
Sequence TGATGAATATAAAGCTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063804452_1063804458 -4 Left 1063804452 10:9622725-9622747 CCCCATAAGCTTTATATTCATCA No data
Right 1063804458 10:9622744-9622766 ATCAACAGGAGTTGGTAGGTAGG No data
1063804452_1063804459 -1 Left 1063804452 10:9622725-9622747 CCCCATAAGCTTTATATTCATCA No data
Right 1063804459 10:9622747-9622769 AACAGGAGTTGGTAGGTAGGAGG No data
1063804452_1063804461 22 Left 1063804452 10:9622725-9622747 CCCCATAAGCTTTATATTCATCA No data
Right 1063804461 10:9622770-9622792 ACTTTCTTCAGGATAAATTTAGG No data
1063804452_1063804457 -8 Left 1063804452 10:9622725-9622747 CCCCATAAGCTTTATATTCATCA No data
Right 1063804457 10:9622740-9622762 ATTCATCAACAGGAGTTGGTAGG No data
1063804452_1063804460 11 Left 1063804452 10:9622725-9622747 CCCCATAAGCTTTATATTCATCA No data
Right 1063804460 10:9622759-9622781 TAGGTAGGAGGACTTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063804452 Original CRISPR TGATGAATATAAAGCTTATG GGG (reversed) Intergenic
No off target data available for this crispr