ID: 1063808650

View in Genome Browser
Species Human (GRCh38)
Location 10:9678310-9678332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063808647_1063808650 -2 Left 1063808647 10:9678289-9678311 CCAGGGTAGCCCAAGAATTAGCA No data
Right 1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG No data
1063808646_1063808650 13 Left 1063808646 10:9678274-9678296 CCTAATGCAAATTCACCAGGGTA No data
Right 1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063808650 Original CRISPR CAAGAATTCTACATTTATAT TGG Intergenic