ID: 1063808650 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:9678310-9678332 |
Sequence | CAAGAATTCTACATTTATAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1063808647_1063808650 | -2 | Left | 1063808647 | 10:9678289-9678311 | CCAGGGTAGCCCAAGAATTAGCA | No data | ||
Right | 1063808650 | 10:9678310-9678332 | CAAGAATTCTACATTTATATTGG | No data | ||||
1063808646_1063808650 | 13 | Left | 1063808646 | 10:9678274-9678296 | CCTAATGCAAATTCACCAGGGTA | No data | ||
Right | 1063808650 | 10:9678310-9678332 | CAAGAATTCTACATTTATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1063808650 | Original CRISPR | CAAGAATTCTACATTTATAT TGG | Intergenic | ||