ID: 1063822832

View in Genome Browser
Species Human (GRCh38)
Location 10:9856772-9856794
Sequence CAGGGTGGCCTTGGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063822832_1063822836 -8 Left 1063822832 10:9856772-9856794 CCTTCTACTCCAAGGCCACCCTG No data
Right 1063822836 10:9856787-9856809 CCACCCTGAGATCTGAAAATGGG No data
1063822832_1063822839 10 Left 1063822832 10:9856772-9856794 CCTTCTACTCCAAGGCCACCCTG No data
Right 1063822839 10:9856805-9856827 ATGGGAAAGAAAGAAATTTCAGG No data
1063822832_1063822834 -9 Left 1063822832 10:9856772-9856794 CCTTCTACTCCAAGGCCACCCTG No data
Right 1063822834 10:9856786-9856808 GCCACCCTGAGATCTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063822832 Original CRISPR CAGGGTGGCCTTGGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr