ID: 1063837221

View in Genome Browser
Species Human (GRCh38)
Location 10:10029517-10029539
Sequence ACTAATATCCAGAATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063837219_1063837221 15 Left 1063837219 10:10029479-10029501 CCTTGGATCATTATCAAGAAATT No data
Right 1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG No data
1063837220_1063837221 -8 Left 1063837220 10:10029502-10029524 CCTAAATGTAAAAGAACTAATAT No data
Right 1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063837221 Original CRISPR ACTAATATCCAGAATGTGCA AGG Intergenic
No off target data available for this crispr