ID: 1063841381

View in Genome Browser
Species Human (GRCh38)
Location 10:10075876-10075898
Sequence CTTTAAAGGCAGATGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063841381_1063841386 -9 Left 1063841381 10:10075876-10075898 CCCACCTTCATCTGCCTTTAAAG No data
Right 1063841386 10:10075890-10075912 CCTTTAAAGCTCCTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063841381 Original CRISPR CTTTAAAGGCAGATGAAGGT GGG (reversed) Intergenic
No off target data available for this crispr