ID: 1063842650

View in Genome Browser
Species Human (GRCh38)
Location 10:10089488-10089510
Sequence CTGCAGGAACAGAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063842650_1063842656 5 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842656 10:10089516-10089538 TCTGCTGGTAGATTTCGGCTTGG No data
1063842650_1063842653 -10 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842653 10:10089501-10089523 GTTCCTGCAGAGGCTTCTGCTGG No data
1063842650_1063842655 0 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842655 10:10089511-10089533 AGGCTTCTGCTGGTAGATTTCGG No data
1063842650_1063842657 6 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842657 10:10089517-10089539 CTGCTGGTAGATTTCGGCTTGGG No data
1063842650_1063842659 25 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842659 10:10089536-10089558 TGGGTAAGTTGTGATTCTCTGGG No data
1063842650_1063842658 24 Left 1063842650 10:10089488-10089510 CCATCCTGGCTCTGTTCCTGCAG No data
Right 1063842658 10:10089535-10089557 TTGGGTAAGTTGTGATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063842650 Original CRISPR CTGCAGGAACAGAGCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr