ID: 1063853683

View in Genome Browser
Species Human (GRCh38)
Location 10:10222544-10222566
Sequence TGAGCTCTCATTAAAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063853683_1063853684 -10 Left 1063853683 10:10222544-10222566 CCACACACTTTAATGAGAGCTCA No data
Right 1063853684 10:10222557-10222579 TGAGAGCTCAAGTATCAATGAGG No data
1063853683_1063853686 -8 Left 1063853683 10:10222544-10222566 CCACACACTTTAATGAGAGCTCA No data
Right 1063853686 10:10222559-10222581 AGAGCTCAAGTATCAATGAGGGG No data
1063853683_1063853687 -4 Left 1063853683 10:10222544-10222566 CCACACACTTTAATGAGAGCTCA No data
Right 1063853687 10:10222563-10222585 CTCAAGTATCAATGAGGGGATGG No data
1063853683_1063853685 -9 Left 1063853683 10:10222544-10222566 CCACACACTTTAATGAGAGCTCA No data
Right 1063853685 10:10222558-10222580 GAGAGCTCAAGTATCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063853683 Original CRISPR TGAGCTCTCATTAAAGTGTG TGG (reversed) Intergenic
No off target data available for this crispr