ID: 1063856234

View in Genome Browser
Species Human (GRCh38)
Location 10:10257324-10257346
Sequence CTGTCTGTGCAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 580}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063856234_1063856242 22 Left 1063856234 10:10257324-10257346 CCCTCCTCCTGCTGCACAGACAG 0: 1
1: 0
2: 4
3: 61
4: 580
Right 1063856242 10:10257369-10257391 TCCTTTTCTGTTCAACAGTCTGG 0: 1
1: 0
2: 2
3: 17
4: 256
1063856234_1063856241 -9 Left 1063856234 10:10257324-10257346 CCCTCCTCCTGCTGCACAGACAG 0: 1
1: 0
2: 4
3: 61
4: 580
Right 1063856241 10:10257338-10257360 CACAGACAGCTCGGTAGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063856234 Original CRISPR CTGTCTGTGCAGCAGGAGGA GGG (reversed) Intergenic
900346995 1:2214777-2214799 GCGCCTGTGCAGCAGGCGGAGGG - Intergenic
900457924 1:2786325-2786347 CTGTCTGAGCACTAGGAGGTTGG + Intronic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900905084 1:5551450-5551472 CTGGCTGTGCAACAGTAGGTAGG + Intergenic
901036987 1:6342179-6342201 CTGTCTGTGAACCAGGAAGCCGG - Intronic
901459378 1:9382617-9382639 CTGCCTGGGCAGCACGAAGAGGG - Intergenic
901642851 1:10701813-10701835 CTGTTAGTTCAGCAGGAGGCAGG - Intronic
901742307 1:11350307-11350329 CTATCAGTGAGGCAGGAGGAGGG - Intergenic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
907787458 1:57626704-57626726 CTATCTGTGAAGCAGGAAGCAGG - Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908255804 1:62302666-62302688 CTGTCTATGAACCAGGAAGAGGG + Intronic
908475160 1:64480047-64480069 CTGTCTTTGGAGCAGAAGCAGGG - Intronic
908850527 1:68371451-68371473 CTGTCTATCGACCAGGAGGAGGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909355066 1:74698585-74698607 CTTTCAGTGAAGCAGGAGAATGG + Intergenic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
912265493 1:108152953-108152975 CTGTCTGTGTTGCTGGAGCAGGG + Intronic
912801684 1:112723390-112723412 CTGTGTGTGCAACAGGCAGAGGG - Intronic
912822879 1:112881828-112881850 CTGTCTGTGTCAGAGGAGGAAGG + Intergenic
913103620 1:115592723-115592745 CCACCTGTGCAGTAGGAGGATGG + Intergenic
914213439 1:145603032-145603054 CTGTCTGTGAACCAGAAGGAGGG - Intergenic
914465376 1:147923481-147923503 CTGTCTGTGAACCAGAAGGAGGG - Intergenic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915462741 1:156079970-156079992 CTAACACTGCAGCAGGAGGAGGG + Intronic
915634548 1:157177094-157177116 CTCTCTGTCCTGCAGGAGCAGGG + Intergenic
916217704 1:162411649-162411671 CAGACTCTGCAGCAGCAGGAGGG - Intronic
916558519 1:165913019-165913041 CTAGCTGTGGAGCTGGAGGATGG - Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917495088 1:175533315-175533337 CTCAGTGTGCAGCAGAAGGAAGG + Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920399396 1:205667872-205667894 CTATCTGGGCTGTAGGAGGATGG - Intronic
920653069 1:207853030-207853052 CGGTCAGTGCAGCTGGTGGAAGG + Intergenic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921032705 1:211347642-211347664 CTGGCTGTTCAGCAGGAGCAAGG + Intronic
921890617 1:220350084-220350106 CAGGCTGTCAAGCAGGAGGAGGG + Intergenic
922130114 1:222769243-222769265 CTGCCTGTGCTGCAGGAGCAAGG + Intergenic
922153197 1:223022354-223022376 CTCCCTGGGCAGCAGAAGGAAGG + Intergenic
922185046 1:223266918-223266940 CTTTCTGTGCAGCAAGATGTGGG + Intronic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1067033962 10:42899356-42899378 GTGTGTGTGCTGCAGAAGGAAGG - Intergenic
1067298484 10:44989658-44989680 CTGCCTGTGCAGGTGGAAGATGG + Exonic
1067741877 10:48901734-48901756 ATGCCTCTGCAGCAGGAGAAAGG + Intronic
1067811199 10:49428691-49428713 CTGATTGTGCGGCACGAGGAGGG + Intergenic
1068690434 10:59908147-59908169 CTGTTTGTATAGCAGGAGGGAGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069535956 10:69253294-69253316 CTGTCTGTTCTGCAGATGGAGGG + Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070273980 10:74986868-74986890 TGGTCAGTGCAGCACGAGGAAGG - Intronic
1070756411 10:78996167-78996189 CACTCTGTGTAGCAGGAGGGGGG - Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1072252400 10:93591792-93591814 ATGTCTGTGCTGCAGACGGATGG - Exonic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072588405 10:96803442-96803464 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1073073594 10:100809760-100809782 CTCTCTGGGAAGCAGGAGGAAGG - Intronic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1074997490 10:118770426-118770448 ATGGCTGGCCAGCAGGAGGATGG + Intergenic
1075682796 10:124344322-124344344 CTGGCTGTGAAGCTGGAGGAAGG - Intergenic
1076059931 10:127405842-127405864 CTGTCTTTGCTGCACGATGAAGG - Intronic
1076076384 10:127537178-127537200 CTGTCTCTGGAGCAGGAAGGAGG + Intergenic
1076309897 10:129497851-129497873 CTCTCTGTGAACCAGGAAGAGGG + Intronic
1076648677 10:131972119-131972141 CTATCTGTGCCGGAGTAGGAAGG + Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077253566 11:1571277-1571299 CTGCCTCTGCAGCAGGCGGAAGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078535828 11:12172828-12172850 CTGCCTGTGCACTGGGAGGATGG - Intronic
1078572760 11:12473744-12473766 GTGTCCGAGCTGCAGGAGGAGGG + Exonic
1078573055 11:12475904-12475926 CTTTCTGTGCAGGAAGAAGATGG + Intronic
1079108010 11:17586312-17586334 CTCACTGAGCAGCAGCAGGATGG + Intronic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1084175010 11:67418484-67418506 CTGCCTGTGCTGCTGGAGGGTGG + Exonic
1084684386 11:70685266-70685288 TTTTCTGGGCGGCAGGAGGAGGG - Intronic
1084745246 11:71165977-71165999 CTGTCTGTGCAGCACGCGGGAGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085120430 11:73964185-73964207 CTGTCTTTGCACTGGGAGGAAGG + Intronic
1085217733 11:74847420-74847442 GTGTCAGTGCAGCAGAAGGGTGG - Intronic
1085739720 11:79068628-79068650 CTGTCTGTGAAGGGGGAGAAGGG + Intronic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1085922140 11:80970122-80970144 GTGTCTGTGCATGAGGAGCAAGG - Intergenic
1086103014 11:83121181-83121203 ATGCCAGTGAAGCAGGAGGAAGG - Intergenic
1086996979 11:93369090-93369112 CTATCTGTGAACCAGGAGAAGGG - Intronic
1087092371 11:94286681-94286703 CAGTCTGTGAAGCAGGAGCAGGG - Intergenic
1087629284 11:100631560-100631582 CTGTCTGTGGAGCAGAAGACAGG + Intergenic
1088202198 11:107350513-107350535 CTGTCTGTGAACCAGGATGTGGG + Intronic
1088536054 11:110862601-110862623 CTCTCTGTGCCCCAGGAGGCTGG - Intergenic
1089691761 11:120191260-120191282 TTGTCTTTGAAGCGGGAGGAGGG + Intergenic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090396435 11:126422328-126422350 GTGTGTGTGTAGCAGGAGCAAGG + Intronic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1090759683 11:129825479-129825501 CTGTCTGTTCAGCAGGTTGTTGG + Intronic
1091129275 11:133131135-133131157 CTGTCTGTGAACCAGGAAGCAGG + Intronic
1091169448 11:133507266-133507288 CCCTCTGTGGAGCAGGAGGATGG + Intronic
1091194185 11:133717909-133717931 CTGTCTGTGAACCAGGAAGTGGG - Intergenic
1091337883 11:134786134-134786156 CAGTCTGAGATGCAGGAGGAAGG - Intergenic
1091391809 12:130528-130550 GGGTCTGTGGAGCATGAGGAGGG + Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091782882 12:3224998-3225020 CTGTGTGTGCAGCTGGTGGTGGG + Intronic
1091918368 12:4285260-4285282 CTCTCTCTGCTGCAGGAGGAAGG + Intronic
1092051816 12:5476308-5476330 GACTCTGTGCAGCAGGAGGCAGG + Intronic
1092452773 12:8618362-8618384 ATATCTGTGTAGCAGGAGGGTGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093286258 12:17267927-17267949 CTGTCAGAGGACCAGGAGGATGG + Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1096069707 12:48768215-48768237 CTGTCTGGGCAGCAGGTTCAGGG - Exonic
1096277464 12:50222323-50222345 TTGTCACTTCAGCAGGAGGATGG + Exonic
1096312130 12:50530636-50530658 CTGTCTCTGCAGTAGGATTAGGG + Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100274806 12:93062372-93062394 CTGTCTATGCAACAGGGAGAGGG - Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1101719145 12:107335960-107335982 TTGTCGGGGCAGGAGGAGGAAGG - Intronic
1102634367 12:114310007-114310029 CTATCTGTGAACCAGGACGAGGG - Intergenic
1103516667 12:121512824-121512846 CTGTCTTTGAGGCAGCAGGAGGG - Intronic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1104468339 12:129008027-129008049 CCGTGGGTGGAGCAGGAGGAAGG - Intergenic
1104706701 12:130952754-130952776 CTCTCTGTGGAGCTGGAGAAGGG - Intergenic
1104858450 12:131912758-131912780 CTGTCAGGGCAACAGGAAGACGG + Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1106895138 13:34291802-34291824 CAGTCTTTGCAGCAGGAGCTGGG + Intergenic
1107029927 13:35840105-35840127 CTGTCTGTGGAGCAGAGAGAAGG + Intronic
1107860184 13:44653251-44653273 CTGTCAGTGAAGCAGGAGAAAGG + Intergenic
1108709215 13:53016544-53016566 CTGACTGTGAAGGTGGAGGAAGG + Intergenic
1109338858 13:61028677-61028699 GTGTGAGTGCACCAGGAGGAGGG - Intergenic
1110709145 13:78630700-78630722 CTGTCTATGAAGCAGGAAGTGGG + Intronic
1112123706 13:96441107-96441129 CTGTCTGTAAACCAGGAAGAGGG + Intronic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112419862 13:99238487-99238509 CTGGCAGTGAGGCAGGAGGAGGG - Exonic
1112574893 13:100627023-100627045 CCGTCTGTGAACCAGGAGGCAGG + Intronic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1114519517 14:23324413-23324435 CTGCCTGTGCAGGTTGAGGAAGG + Intronic
1114570415 14:23663362-23663384 CTGTCTGTTCACCAGGAAGAGGG + Intergenic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG + Intergenic
1115369829 14:32600754-32600776 GTGTCTGTGGAGGATGAGGAAGG + Exonic
1115882823 14:37939320-37939342 CTGCCTGTGCAGTTGCAGGAGGG + Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1117478980 14:56124654-56124676 CTGTCAGTGCTGCAGCAGCAGGG - Intronic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1118386710 14:65261751-65261773 CTGTCTGTGAACCAGGAAGCAGG - Intergenic
1119566895 14:75636472-75636494 CTTGCTCTGCGGCAGGAGGAGGG + Intronic
1119905392 14:78297607-78297629 CTTTCTGCCCAGCAGCAGGAAGG + Intronic
1120214993 14:81672193-81672215 CTCTCTGTGCAGCATGTGGTAGG - Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1122324642 14:100875010-100875032 CTTTCTGTGCCCCAAGAGGAGGG + Intergenic
1122386281 14:101350476-101350498 TTTTCTGAGCAGCAGGAGGGTGG - Intergenic
1123482292 15:20643300-20643322 TTGTCTGTGCAGCAGGCAGGGGG - Intergenic
1123504769 15:20930006-20930028 CTCCCTGTGCAGCCTGAGGAAGG - Intergenic
1123562016 15:21503701-21503723 CTCCCTGTGCAGCCTGAGGAAGG - Intergenic
1123598262 15:21940988-21941010 CTCCCTGTGCAGCCTGAGGAAGG - Intergenic
1124247566 15:28084165-28084187 CTGTCTGTGAACCAGGAGGTGGG + Intronic
1124952611 15:34337680-34337702 CTGACTGGGCAGCAGGGTGAGGG + Exonic
1125102635 15:35932706-35932728 CCATCTGTGAACCAGGAGGAGGG - Intergenic
1125750481 15:42024319-42024341 TTGTCTCTGCAGCAAGGGGAGGG + Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1127532055 15:59852959-59852981 CTGTCTGTGAGCCAGGAAGAGGG - Intergenic
1127931786 15:63601552-63601574 ATCTCGGTGAAGCAGGAGGAGGG + Exonic
1128381936 15:67119555-67119577 CTGTCTATGAAGCAGATGGATGG + Intronic
1128607374 15:69047072-69047094 CTGTCTCTTCACCAGGAGCAGGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129692544 15:77721927-77721949 CTGGCTCTGCAGCGGGAAGAGGG - Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130689571 15:86069946-86069968 CTGTCTATGAACCAGGAAGAGGG - Intergenic
1131952235 15:97693312-97693334 CCGTCTGGGCTCCAGGAGGAGGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132343096 15:101090307-101090329 CTGTCTGTGCAGCTGGATCGTGG + Intergenic
1202970361 15_KI270727v1_random:230839-230861 CTCCCTGTGCAGCCTGAGGAAGG - Intergenic
1132579432 16:678307-678329 CGGTCTGTGCAGCAGGTGTGGGG - Intronic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133810041 16:9154657-9154679 CTGCTTGTGATGCAGGAGGAGGG + Intergenic
1135687172 16:24507187-24507209 CTGTCTGTGCAGCAGATGCCTGG + Intergenic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1138124614 16:54428593-54428615 CTGTCTGCCCAGCAGCTGGAGGG + Intergenic
1138241306 16:55429430-55429452 ATGTGTGTGCAGCAGGAACATGG + Intronic
1138382287 16:56610996-56611018 CTGACTGTGTACCAGGGGGAGGG + Intergenic
1138535615 16:57658783-57658805 CTATCTGTGAAGTGGGAGGATGG - Intronic
1139522401 16:67491742-67491764 CTAGCAGTGCTGCAGGAGGAAGG - Intergenic
1140093048 16:71852762-71852784 CGGTCAGCGCAGCAGGAGGGTGG - Exonic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1141160635 16:81627373-81627395 TTGTTTGTGCAGCAGGCAGAAGG + Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141496880 16:84416561-84416583 CTGTCTGTGAAATAGGAGGCAGG + Intronic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1143621225 17:8081138-8081160 TTTTCTGTGCTCCAGGAGGACGG + Exonic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144578799 17:16446505-16446527 GTGTCTGTGAACCAGCAGGAAGG + Intronic
1144731813 17:17530611-17530633 CAGGCTGTGCGGCAGGAGGGAGG - Intronic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1146192356 17:30780648-30780670 GTGTCTGTGCAGGATGAAGAAGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1147259236 17:39198751-39198773 CTTTCTGTGGAGCAGGAGAAGGG - Intergenic
1147275843 17:39315735-39315757 TTGTCCGTGCAACAGGAGGAAGG + Intronic
1147783941 17:42964526-42964548 TTGTCTGCGCAGAAGCAGGAGGG + Intronic
1149478627 17:56984251-56984273 CTCTCTGTGCACTAGCAGGATGG - Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1150942920 17:69712929-69712951 TTCTCCGTGCAGCAGGATGAGGG + Intergenic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151339253 17:73459206-73459228 GGGTCTGTGCAGCTGGAGTAAGG - Intronic
1151392529 17:73797404-73797426 CTGTTCGTGGAGCAGGTGGAAGG - Intergenic
1151479159 17:74360237-74360259 CTCTCTGTGCTGCAGCAGGAAGG + Exonic
1152284119 17:79402673-79402695 TTGTCTGTGAAACAGGAGGCTGG + Intronic
1152374458 17:79911925-79911947 CTGTCTCTGAAGCACCAGGATGG - Intergenic
1152848853 17:82619452-82619474 CTCCCTGTGTAGCAGGAGCAGGG - Intronic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154038998 18:10835085-10835107 CTATCTGTGAACCAGGAAGAGGG + Intronic
1154350641 18:13580421-13580443 CTGTCTCTGCAGCCAGAGGATGG + Intronic
1155374415 18:25139955-25139977 CTGTCTATGAAGCAGGAAGCTGG + Intronic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156486910 18:37472198-37472220 CTGGCTGTGCTGGAAGAGGAGGG - Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157583087 18:48784572-48784594 CTCTCTCTGCAGCAGGATGGAGG + Intronic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158855627 18:61540742-61540764 CTCTCTGTGCAGCAAGATGCTGG - Intronic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159007644 18:63026659-63026681 CTGTCTGTGAACCAGGAAGAGGG + Intergenic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1159899898 18:74036342-74036364 CTGGCTGTCAAGCAGAAGGAAGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160209061 18:76860998-76861020 GTGTCTGTGCTGCCGGAGGAAGG + Intronic
1160408360 18:78658669-78658691 GTGCCCCTGCAGCAGGAGGAAGG + Intergenic
1160693784 19:472721-472743 CTGTCTGTGCCCCAGGGTGAGGG - Intronic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1161124347 19:2547412-2547434 GTGTCTGTGAAGGGGGAGGAAGG - Intronic
1161589380 19:5122228-5122250 GTGGCTGTGAAGGAGGAGGAAGG - Intronic
1161655292 19:5510658-5510680 CTGGCTGTGAAGGTGGAGGAGGG - Intergenic
1161660704 19:5544189-5544211 CTGGCGGTTCAGCAGGAGGGAGG - Intergenic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1161889136 19:7021421-7021443 CTGTCTGTGCCTCAGGAGTGGGG - Intergenic
1161892316 19:7049328-7049350 CTGTCTGTGCCTCAGGAGTGGGG + Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163241301 19:16065529-16065551 CTGTCTGTGTAGCATGGGGGAGG + Intergenic
1164237040 19:23346333-23346355 CTGCCTGTGCACCAGTAGGCTGG - Intronic
1164502965 19:28834712-28834734 CTGCCTATGCAGCAGGTGGCTGG - Intergenic
1164862767 19:31575681-31575703 GTGTCTGTGCTCCAGGAGGCAGG + Intergenic
1165927525 19:39336053-39336075 CGGGCTGTGCAGTAGGAGGAAGG + Exonic
1166129747 19:40739195-40739217 CTGTCTGTGCAGCCTTAGGCAGG - Intronic
1166806128 19:45488477-45488499 CTGCCGGTACAGCAGGGGGATGG + Exonic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167736637 19:51298405-51298427 CTGTCTGTGAACCAGGATGCCGG + Intergenic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1168432717 19:56294057-56294079 CTGTCAGTGCAGCATGAGGACGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925165760 2:1714614-1714636 CTGTCTCTGCAGCAGGAATGCGG + Intronic
925763224 2:7206753-7206775 CTGACTTTGCAGCAGCTGGATGG - Intergenic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
926089293 2:10040008-10040030 CTGTCTGTCCATCTGGAAGATGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926229313 2:10990731-10990753 CAGGCTGTGCAACAGGAGCATGG + Intergenic
927277238 2:21272427-21272449 CTGTCTGAGCAACAGGAGTCAGG + Intergenic
928185431 2:29105804-29105826 CTGTCTGTGAACCAGGCAGAGGG + Intronic
928262257 2:29778571-29778593 GTGTGTGTGCAGCAGGAGTGAGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929256702 2:39818887-39818909 CTGTCTGTGAATCAGGAAGCAGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929749456 2:44694662-44694684 CTGTCTGTGTAGCAAGAGTGAGG - Intronic
930334600 2:50029187-50029209 CTATCTGTGAAGCAGGAAGCAGG + Intronic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
932129010 2:69170418-69170440 CTGCCTGTGAAGCAGAAGGGAGG + Intronic
932134339 2:69215085-69215107 CAGCCTGTGCAGCAGGATGGAGG - Intronic
932251217 2:70245950-70245972 CAGCCTGTGCAACAGGAGGGAGG - Intronic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935335097 2:102008620-102008642 CTGTGTGTGCCGCAGGCTGAAGG - Exonic
935463650 2:103368765-103368787 CTGTCTATGAACCAGGAAGAGGG - Intergenic
935643036 2:105308689-105308711 ATTTCTGTGAGGCAGGAGGATGG + Intronic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936252461 2:110877145-110877167 CTGGCTGTGCTGGAGAAGGAGGG - Intronic
937015541 2:118602098-118602120 CTGTCTGTGAGGGTGGAGGAAGG + Intergenic
937067155 2:119026158-119026180 CTGGCAGTGCGGCAGGCGGAGGG - Intergenic
937331649 2:121034283-121034305 CTGTCTGTAAACCAGGAGGAGGG - Intergenic
938775414 2:134537388-134537410 CAGTCTGTGAGCCAGGAGGAGGG - Intronic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
941000847 2:160202371-160202393 ATGTTTGTGGTGCAGGAGGAGGG + Intronic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941643559 2:168015497-168015519 CTGTCTGTGCAACAGAAGCAGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943896005 2:193360494-193360516 CTGTCAGTACAGCTGGATGAGGG + Intergenic
945316867 2:208378650-208378672 CTGTCTGTGAACCAGGAAGCAGG + Intronic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946280360 2:218661767-218661789 CTAGCCTTGCAGCAGGAGGAAGG + Exonic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
948217080 2:236239854-236239876 GTGTCTGTGCCGGAGGAGGCTGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948668490 2:239551424-239551446 CTGTCTGTGAACCAGGATGCGGG + Intergenic
948858576 2:240742091-240742113 CTGGCTCTGCAGCAGCTGGAGGG + Intronic
948920164 2:241062578-241062600 GTGTCTGTGAAGCAGCAGGGCGG - Intronic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169587922 20:7107264-7107286 CCATCTGTGAACCAGGAGGAAGG + Intergenic
1170628706 20:18049800-18049822 AGGTCTGTGGGGCAGGAGGAGGG + Intronic
1170693595 20:18637278-18637300 CTGCCTGTGTGGCAGGGGGAAGG - Intronic
1170916111 20:20627656-20627678 CTTTCTGTGCAGCAGAGGGAGGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1174428101 20:50447766-50447788 GTGTCTGTGAAGCAGCAAGAAGG + Intergenic
1175115420 20:56678561-56678583 AAATCTGTACAGCAGGAGGATGG + Intergenic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179182490 21:39057629-39057651 CTGGCTTTGAAGGAGGAGGAAGG - Intergenic
1179919514 21:44499929-44499951 CTGTCTGTTCCGCAGGTGGCAGG - Exonic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181286478 22:21756057-21756079 CTGTCTGGTCGGCAGCAGGAAGG - Exonic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1181871088 22:25899881-25899903 CTGTCTGTGAAACAAGAGGTTGG + Intronic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1181997745 22:26896105-26896127 CTGGCTGGGAAGCAGAAGGAAGG + Intergenic
1182143470 22:27982399-27982421 CTGTCCCTGCAGCAGCATGACGG - Exonic
1182978260 22:34643681-34643703 CTAAGTGTGCAGCAGGAGAAGGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183428699 22:37752862-37752884 CTGTCTGTGCACCAAGGGGTTGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1183936516 22:41265526-41265548 CTGTTCGTGCAGGAGGAGGGAGG + Intronic
1184330216 22:43822310-43822332 CTGGCTGGCCGGCAGGAGGATGG + Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
1185248901 22:49789367-49789389 GTGCCTGTACAGCAGCAGGAGGG + Intronic
1185374420 22:50475379-50475401 CTCTCTGTCCAGCGGGAGAAAGG + Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950528113 3:13536367-13536389 CTGTCTGTGATGGAGGAGGCCGG + Intergenic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951319874 3:21231382-21231404 CTGTCTGTGAATCAGGAAGCAGG + Intergenic
951840061 3:27024648-27024670 CTGTAAGTGCAGCAGAGGGAAGG - Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953137696 3:40197314-40197336 CAGCCTGTGCAGCAGGAGGTGGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953634216 3:44648780-44648802 CTGGCTCTGCAGCAGGAGGCTGG - Exonic
955596121 3:60592588-60592610 CTGCCTGGGCAGCAGGATGGAGG + Intronic
956932704 3:74063645-74063667 TTGTTTGGGCAGCAGCAGGAGGG - Intergenic
959398193 3:105868384-105868406 GGGTCTGAGCTGCAGGAGGAAGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
966792820 3:183689482-183689504 CTGTCTGTGAATTAGGAGAAGGG - Intergenic
966879550 3:184342234-184342256 CTCGCTTTGCAGCAGGTGGATGG + Exonic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
967774907 3:193376296-193376318 CAGTCTATGCACCAGAAGGAGGG - Intronic
968278458 3:197458291-197458313 CTGTCTGTTCAGCAGCTGGGTGG + Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968577432 4:1374430-1374452 CAGGCTGTGGTGCAGGAGGAGGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968591435 4:1461670-1461692 CTGTCTGGGAAGCACGGGGAAGG - Intergenic
968737705 4:2305933-2305955 CTGGCTATGCAGCAGGAGCTGGG + Intronic
968778375 4:2559765-2559787 CTGTCCGTGCAGCCGGAGTCTGG - Intronic
968922062 4:3527413-3527435 CAGTCGGTGCCTCAGGAGGAGGG + Intronic
969408658 4:7013368-7013390 GTGTCTGTGCATCCGAAGGAGGG - Intronic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
971112603 4:23605842-23605864 CTGTCTATGCATCAGGAAGTGGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972802572 4:42492558-42492580 CTGTCTATGAACCAGGAAGAAGG + Intronic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
974093502 4:57336829-57336851 TTTTCAGAGCAGCAGGAGGATGG + Intergenic
976426010 4:84904130-84904152 CTGTCTGTGAACCAGGAAGTGGG + Intronic
976912404 4:90323595-90323617 CTGTCTGTGCTGCCAGAGGATGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977615136 4:99080190-99080212 TTTTCTTTGCAGCAGGAGGGAGG + Intronic
978361135 4:107931898-107931920 CTGGCTGAGCAGCAGGACCAGGG + Exonic
978410506 4:108419566-108419588 CTGCTTGTGCACCAGGATGATGG + Intergenic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
979551218 4:121993093-121993115 CTGTCCTGGCATCAGGAGGAGGG + Intergenic
980871310 4:138614233-138614255 CTTTCTCTGCTCCAGGAGGAAGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981726060 4:147848408-147848430 CTGGCTTTGCAGCAGGAGATCGG + Intronic
981872611 4:149504949-149504971 CTGTCTATGAACCAGGAGGCAGG + Intergenic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983850018 4:172569232-172569254 CTGTCTATGAACCAGGAGGTGGG - Intronic
984076943 4:175195071-175195093 CTTTCTGTGCAGCAGGCAGCAGG + Intergenic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985524259 5:394148-394170 CTGTCTGGGTGGCAGGAGGGAGG + Intronic
985914458 5:2906930-2906952 CTGTCTCTGCAGAAAGATGATGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986164633 5:5263350-5263372 CTGACAGTGCAGCAGGACCATGG - Intronic
987491190 5:18582276-18582298 TTGTCTGTGCAGCAGGCTGAAGG - Intergenic
988397553 5:30714198-30714220 CTGTCTGTGAACCAGGAAGCAGG + Intergenic
988430716 5:31115428-31115450 CTGTCAGGGGAGCAGGAAGAGGG + Intergenic
988482454 5:31641191-31641213 GTTTCTGTCCAGCAGGAGAAGGG + Intronic
988814952 5:34825655-34825677 CTGGCCGTGCTGCTGGAGGAAGG + Intronic
989527341 5:42468483-42468505 CTGGCTCTGCAGCAGGAGGCTGG + Intronic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992090164 5:73309979-73310001 CTGTCTGTGCTGCTGGAAAAGGG + Intergenic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
992500693 5:77339754-77339776 CAGTCTGTACTGCAGGATGATGG + Intronic
992634669 5:78716074-78716096 CTGTCTGAGCAGCACCATGATGG - Intronic
993692987 5:91025639-91025661 CTGAATGTGCAGCAGAAGGGTGG - Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
998523416 5:142820609-142820631 GTATCTGTGCAGCAGTGGGATGG + Intronic
999474031 5:151881665-151881687 GAGTCTGTGCAGCAAGAGGAAGG - Intronic
1000826877 5:166055896-166055918 CTGTCTGTGCTACAAGATGATGG + Intergenic
1000964467 5:167639503-167639525 CTTTTTGTGAAGCAGGAAGAAGG - Intronic
1001217661 5:169870990-169871012 CTGTCTGTAGACCAGGAAGAGGG - Intronic
1001525462 5:172425595-172425617 CTGACAGTGCTGCGGGAGGAAGG + Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1002691679 5:181054307-181054329 GTGCCTGTGCAGTGGGAGGAGGG + Intronic
1002694190 5:181073122-181073144 GTGTCGGAGAAGCAGGAGGATGG + Intergenic
1002769599 6:279791-279813 CTGTCTGTGAGGCCGGAGGCTGG + Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1004604765 6:17183553-17183575 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006518096 6:34555734-34555756 CAGTCTGGGGAGCATGAGGAGGG + Intronic
1006609618 6:35286345-35286367 CAGCCTGTGCAGCTGGAAGATGG + Exonic
1007072953 6:39049630-39049652 CTGTCAGTGCAGGATGAGAATGG - Intronic
1007164887 6:39822134-39822156 AAGTCTATGCAGCAGGGGGATGG + Intronic
1008321837 6:50123691-50123713 CAGGCTGTGGATCAGGAGGATGG - Intergenic
1010039691 6:71366904-71366926 CTTTCTGTGCAGCAAGCGGCAGG + Intergenic
1010620446 6:78067684-78067706 CTCTCTGTGCAGCAGGTTGAGGG - Intergenic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1011524326 6:88246917-88246939 CAGTCTGTGCCTCAGGAGAAGGG + Intergenic
1012096830 6:94972766-94972788 CTGCCAGTGCAGCTGGAAGAAGG - Intergenic
1012408187 6:98924843-98924865 CTGCCAGTGCAGGAGGAGGCGGG - Intronic
1013386415 6:109636165-109636187 GGGTTTGTGCAGTAGGAGGAAGG - Intronic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015804012 6:137090338-137090360 CCATCTGTGCACCAGGAAGAGGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1017991096 6:159490471-159490493 GTGTCTGAGCAGCAGGAGATGGG - Intergenic
1018185270 6:161261162-161261184 CTGACTGTTCAGCGGGAGGCAGG - Intronic
1018335173 6:162779025-162779047 CTGTCAGTGGAGCAGAGGGAGGG - Intronic
1018588058 6:165384926-165384948 CTGTCTGTGTGGCCAGAGGATGG + Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019154347 6:170029225-170029247 GTGTCCTTGCAGCAGGAGGCTGG + Intergenic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1020022415 7:4877123-4877145 TTGTCTACGCAGCAGGAGGCTGG - Intronic
1020463521 7:8450164-8450186 ATGTCTTGGCAGCAGGAGGTGGG + Intronic
1021452697 7:20797727-20797749 TTGTCTGTGCAGCAGTCAGAGGG + Intergenic
1021688564 7:23211041-23211063 TTCTCTGTGAAGCAGGAGGTGGG - Intergenic
1022893339 7:34723475-34723497 CTTTCTGTGCAGGAGGAAGGGGG + Intronic
1023177662 7:37448915-37448937 GTCTCTGGCCAGCAGGAGGAAGG - Exonic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023818730 7:43968748-43968770 CTGCCTGTGAGGCAGGAGGGTGG - Intergenic
1024153907 7:46600742-46600764 TTGTCTGTACAGCAGGAAGATGG - Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024709179 7:51996053-51996075 CTGGCTGTACTGCAGGGGGAGGG + Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1026055577 7:66980815-66980837 CTTTCTGTGCAGCAAGCGGCAGG + Intergenic
1026722116 7:72841004-72841026 CTTTCTGTGCAGCAAGCGGCAGG - Intergenic
1026844923 7:73693437-73693459 CTGCCTGGGCTGCAGGAGGGAGG + Intronic
1028450532 7:90977251-90977273 CTTTCTGTGCAGCAGGCAAATGG - Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1029580472 7:101433739-101433761 CTGTCAGAGCAGCAACAGGAGGG + Intronic
1029742804 7:102500747-102500769 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1029743779 7:102505714-102505736 CTGCCTGTGAGGCAGGAGGGTGG - Intronic
1029760794 7:102599908-102599930 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1029761766 7:102604877-102604899 CTGCCTGTGAGGCAGGAGGGTGG - Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030902317 7:115139928-115139950 CTATCTGTGCAGAAAAAGGAGGG + Intergenic
1030934498 7:115568449-115568471 CTGTCTCTGAATCAGGAGAAGGG - Intergenic
1031397193 7:121287248-121287270 GTGTCTGTGTGGCAGGAGGTTGG - Intronic
1031512126 7:122663952-122663974 CTGTCTGTGAATCAGGAAGCAGG + Intronic
1032224749 7:130022349-130022371 CTGTTTGTGCGCCAAGAGGATGG + Exonic
1032251599 7:130262332-130262354 CTGCCTGTGCACTGGGAGGATGG + Intergenic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032457905 7:132087547-132087569 CTGTGTGTGCTGCTGGAGGTGGG - Intergenic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1033773910 7:144585089-144585111 CTGACTCTTCAGCAGGAAGATGG + Intronic
1034338399 7:150337800-150337822 CTGTCCTTGCAGCATGTGGAGGG - Exonic
1034709570 7:153178970-153178992 CTTTTTGAGCAGCAGGAGAATGG - Intergenic
1034729323 7:153370328-153370350 CTGTCCCTGCTGCAGCAGGATGG + Intergenic
1034954707 7:155327375-155327397 CTTTCTGTCCAGGTGGAGGAGGG - Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035052258 7:156005632-156005654 CTCTCTTTGCAGCAGAAGGAGGG + Intergenic
1035357085 7:158282669-158282691 CTGTGTGTGGAGCACCAGGAGGG - Intronic
1035581426 8:741959-741981 CTGTCTGTGGAGGAGAAGGGCGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037587932 8:20290804-20290826 TTGGCTTTGAAGCAGGAGGAAGG + Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038190626 8:25317096-25317118 ATGTCTGTGCACGATGAGGAGGG + Exonic
1038817480 8:30919912-30919934 CTGTCTGTAAGCCAGGAGGAGGG + Intergenic
1038840824 8:31183310-31183332 CTGTCGGAGCTTCAGGAGGAGGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040658054 8:49535149-49535171 TTGTCTGTGCAGCAGGCTGGAGG + Intergenic
1041869574 8:62617606-62617628 CTTTCTATGCAACAGGAGAAAGG - Intronic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045495456 8:102704201-102704223 CTTTCTGTGCAGCAAGTGGCAGG + Intergenic
1046114258 8:109766029-109766051 GAGTCTGTGCACCTGGAGGAGGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1048245513 8:132793086-132793108 CTGTCAGAGCAGCAGGAGCCGGG + Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049386105 8:142343908-142343930 CACTCTGTCCAGCAGGAGGGGGG - Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050366781 9:4880161-4880183 CTGGCTGTGAAGCAGAAGAAAGG - Intronic
1051575909 9:18615307-18615329 CTGCCTGTGTGGCAGGGGGAGGG + Intronic
1051708253 9:19903263-19903285 CTGTCTGTGAACTAGGAGGAGGG - Intergenic
1051915622 9:22203653-22203675 CTGGCTGTGCTGCAAGAAGAGGG + Intergenic
1052399138 9:27978549-27978571 CTGTCTGTGAACCAGGAAGTGGG + Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053280134 9:36815133-36815155 CTGGCATTGCAGCAGGAAGAAGG + Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055000656 9:71446281-71446303 CTGTCTGTGCAGCATGTCGAAGG - Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056948883 9:91026069-91026091 GTGTCAGGGAAGCAGGAGGAAGG - Intergenic
1058339529 9:103877737-103877759 CTGTCTGTAAGCCAGGAGGAGGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058718467 9:107742524-107742546 CTCACAGTGCAGCAGGAAGAGGG - Intergenic
1058941128 9:109813641-109813663 CTGTCTGTGCTGCAGGTTTAGGG + Intronic
1059104511 9:111500233-111500255 CTGTCTGTGAACCAGGAAGTGGG - Intergenic
1059557726 9:115298253-115298275 GAGTCTCTGCAACAGGAGGATGG + Intronic
1060398083 9:123330285-123330307 CTCTCTGTGCATGAAGAGGAGGG - Intergenic
1060854932 9:126907606-126907628 CTATCTGTGCTCCAGCAGGAGGG + Intergenic
1061417328 9:130454205-130454227 CTGTCTCTGTAGCAGGGGGTGGG + Intronic
1061659127 9:132116632-132116654 CTTTCTGAGCAGCATGAGAATGG + Intergenic
1061867246 9:133499201-133499223 CTATCTGTCCAGCAGGGGCAGGG - Intergenic
1062196364 9:135276402-135276424 TTGTCTGTGTGGCAGGAGGTTGG - Intergenic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062402102 9:136377270-136377292 CTGGCTGGGCAGCATCAGGATGG + Intronic
1062462426 9:136667492-136667514 CTGGCTGTGCAGCAGGAGCCAGG - Intronic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1185639807 X:1583122-1583144 CCGTCCGTGCTGCAGAAGGATGG + Intergenic
1185685526 X:1925277-1925299 ATGTCGGTGCGCCAGGAGGACGG + Intergenic
1185975057 X:4710897-4710919 CCGTGTGTGCATTAGGAGGATGG + Intergenic
1186083705 X:5962818-5962840 CTGTCTGTGGACCAGGAAGTGGG + Intronic
1186121913 X:6372550-6372572 ATGTCTGTGCAACAGGATAATGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186417588 X:9397356-9397378 CAGCCTGGGCAGCAGAAGGAGGG - Intergenic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1187715827 X:22101626-22101648 CTCTCTATTCAGCTGGAGGATGG + Intronic
1188220595 X:27536791-27536813 CCGCCTGTGCACCAGGAGAACGG - Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188933818 X:36148574-36148596 ATGTCTCTGGATCAGGAGGAAGG + Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189491270 X:41473375-41473397 CTGTCCGGGCAGCAGGATGCAGG - Intronic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1192986940 X:76409753-76409775 CTGTCAGTGAAGGAAGAGGAAGG + Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195664671 X:107418079-107418101 CTATCTGACCAGCAGGTGGAAGG - Intergenic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1197708347 X:129649612-129649634 ATGTCTGTGCACCAGGAGGGGGG + Intronic
1198143919 X:133835450-133835472 CTTTCTGTGCAGAAAAAGGATGG - Intronic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199743319 X:150756267-150756289 CTGTTAGTCCAGCAGTAGGAGGG + Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1201642506 Y:16194584-16194606 CTGTGGGTGCACTAGGAGGATGG - Intergenic
1201660308 Y:16390736-16390758 CTGTGGGTGCACTAGGAGGATGG + Intergenic