ID: 1063864874

View in Genome Browser
Species Human (GRCh38)
Location 10:10353112-10353134
Sequence ATATCCCTCTTGCAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063864864_1063864874 18 Left 1063864864 10:10353071-10353093 CCCCGCCACTTCAGGAATTCTCA No data
Right 1063864874 10:10353112-10353134 ATATCCCTCTTGCAGTATGTGGG No data
1063864866_1063864874 16 Left 1063864866 10:10353073-10353095 CCGCCACTTCAGGAATTCTCAGT No data
Right 1063864874 10:10353112-10353134 ATATCCCTCTTGCAGTATGTGGG No data
1063864865_1063864874 17 Left 1063864865 10:10353072-10353094 CCCGCCACTTCAGGAATTCTCAG No data
Right 1063864874 10:10353112-10353134 ATATCCCTCTTGCAGTATGTGGG No data
1063864867_1063864874 13 Left 1063864867 10:10353076-10353098 CCACTTCAGGAATTCTCAGTTTG No data
Right 1063864874 10:10353112-10353134 ATATCCCTCTTGCAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063864874 Original CRISPR ATATCCCTCTTGCAGTATGT GGG Intergenic
No off target data available for this crispr