ID: 1063870536

View in Genome Browser
Species Human (GRCh38)
Location 10:10412238-10412260
Sequence TTTTCAGCTGGGTCCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063870530_1063870536 27 Left 1063870530 10:10412188-10412210 CCTGACTAGTCATTGACTGCCTC No data
Right 1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG No data
1063870532_1063870536 8 Left 1063870532 10:10412207-10412229 CCTCCTTGACTTGAGTGTTGGCA No data
Right 1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG No data
1063870533_1063870536 5 Left 1063870533 10:10412210-10412232 CCTTGACTTGAGTGTTGGCAGCT No data
Right 1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063870536 Original CRISPR TTTTCAGCTGGGTCCCTCCA TGG Intergenic
No off target data available for this crispr