ID: 1063872262

View in Genome Browser
Species Human (GRCh38)
Location 10:10430927-10430949
Sequence GATGCTAAAGACCCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063872257_1063872262 26 Left 1063872257 10:10430878-10430900 CCTGTCCAATGATCTAGATTGTG No data
Right 1063872262 10:10430927-10430949 GATGCTAAAGACCCTGTGGGTGG No data
1063872258_1063872262 21 Left 1063872258 10:10430883-10430905 CCAATGATCTAGATTGTGCTGAT No data
Right 1063872262 10:10430927-10430949 GATGCTAAAGACCCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063872262 Original CRISPR GATGCTAAAGACCCTGTGGG TGG Intergenic
No off target data available for this crispr