ID: 1063873409

View in Genome Browser
Species Human (GRCh38)
Location 10:10445032-10445054
Sequence GTGAACATTACGAAAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063873409_1063873411 -5 Left 1063873409 10:10445032-10445054 CCTGCCACTTTCGTAATGTTCAC No data
Right 1063873411 10:10445050-10445072 TTCACAAGATTTCATTAATCTGG No data
1063873409_1063873413 26 Left 1063873409 10:10445032-10445054 CCTGCCACTTTCGTAATGTTCAC No data
Right 1063873413 10:10445081-10445103 GTGGTACTCTATTCTATCTAAGG No data
1063873409_1063873412 7 Left 1063873409 10:10445032-10445054 CCTGCCACTTTCGTAATGTTCAC No data
Right 1063873412 10:10445062-10445084 CATTAATCTGGAGCATGCTGTGG No data
1063873409_1063873414 27 Left 1063873409 10:10445032-10445054 CCTGCCACTTTCGTAATGTTCAC No data
Right 1063873414 10:10445082-10445104 TGGTACTCTATTCTATCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063873409 Original CRISPR GTGAACATTACGAAAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr