ID: 1063882234

View in Genome Browser
Species Human (GRCh38)
Location 10:10542942-10542964
Sequence CTGAAAATACAGACTGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063882234_1063882236 2 Left 1063882234 10:10542942-10542964 CCATTGTCAGTCTGTATTTTCAG No data
Right 1063882236 10:10542967-10542989 TCTCAGGCAGAAGAGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063882234 Original CRISPR CTGAAAATACAGACTGACAA TGG (reversed) Intergenic
No off target data available for this crispr