ID: 1063882236

View in Genome Browser
Species Human (GRCh38)
Location 10:10542967-10542989
Sequence TCTCAGGCAGAAGAGTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063882233_1063882236 7 Left 1063882233 10:10542937-10542959 CCAGGCCATTGTCAGTCTGTATT No data
Right 1063882236 10:10542967-10542989 TCTCAGGCAGAAGAGTCCTTTGG No data
1063882234_1063882236 2 Left 1063882234 10:10542942-10542964 CCATTGTCAGTCTGTATTTTCAG No data
Right 1063882236 10:10542967-10542989 TCTCAGGCAGAAGAGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063882236 Original CRISPR TCTCAGGCAGAAGAGTCCTT TGG Intergenic
No off target data available for this crispr