ID: 1063882256

View in Genome Browser
Species Human (GRCh38)
Location 10:10543109-10543131
Sequence TCTAGCAAACAGATGTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063882254_1063882256 12 Left 1063882254 10:10543074-10543096 CCAGCAGGTTTCTGAATTAGGTT No data
Right 1063882256 10:10543109-10543131 TCTAGCAAACAGATGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063882256 Original CRISPR TCTAGCAAACAGATGTCTGT TGG Intergenic
No off target data available for this crispr