ID: 1063883551

View in Genome Browser
Species Human (GRCh38)
Location 10:10554601-10554623
Sequence CAGGGTCACCACAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063883551_1063883562 12 Left 1063883551 10:10554601-10554623 CCAGCCTCCCTGTGGTGACCCTG No data
Right 1063883562 10:10554636-10554658 AGGTGCATTACTTCTCCCAGTGG No data
1063883551_1063883557 -8 Left 1063883551 10:10554601-10554623 CCAGCCTCCCTGTGGTGACCCTG No data
Right 1063883557 10:10554616-10554638 TGACCCTGGCTGATGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063883551 Original CRISPR CAGGGTCACCACAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr