ID: 1063886628

View in Genome Browser
Species Human (GRCh38)
Location 10:10586569-10586591
Sequence GGGAAGCTATGCCGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063886624_1063886628 8 Left 1063886624 10:10586538-10586560 CCTTTGAAGCTTGTCATTTTGGA No data
Right 1063886628 10:10586569-10586591 GGGAAGCTATGCCGTGTAGTGGG No data
1063886622_1063886628 9 Left 1063886622 10:10586537-10586559 CCCTTTGAAGCTTGTCATTTTGG No data
Right 1063886628 10:10586569-10586591 GGGAAGCTATGCCGTGTAGTGGG No data
1063886621_1063886628 10 Left 1063886621 10:10586536-10586558 CCCCTTTGAAGCTTGTCATTTTG No data
Right 1063886628 10:10586569-10586591 GGGAAGCTATGCCGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063886628 Original CRISPR GGGAAGCTATGCCGTGTAGT GGG Intergenic
No off target data available for this crispr