ID: 1063886824

View in Genome Browser
Species Human (GRCh38)
Location 10:10588337-10588359
Sequence GTGGGACAAGGTTGGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063886824_1063886834 18 Left 1063886824 10:10588337-10588359 CCCTAGCTCCAACCTTGTCCCAC No data
Right 1063886834 10:10588378-10588400 AAGCTGTCACTTACTCCTCTGGG No data
1063886824_1063886833 17 Left 1063886824 10:10588337-10588359 CCCTAGCTCCAACCTTGTCCCAC No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063886824 Original CRISPR GTGGGACAAGGTTGGAGCTA GGG (reversed) Intergenic
No off target data available for this crispr