ID: 1063886827

View in Genome Browser
Species Human (GRCh38)
Location 10:10588345-10588367
Sequence CAGCCAGTGTGGGACAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063886827_1063886834 10 Left 1063886827 10:10588345-10588367 CCAACCTTGTCCCACACTGGCTG No data
Right 1063886834 10:10588378-10588400 AAGCTGTCACTTACTCCTCTGGG No data
1063886827_1063886836 26 Left 1063886827 10:10588345-10588367 CCAACCTTGTCCCACACTGGCTG No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886827_1063886833 9 Left 1063886827 10:10588345-10588367 CCAACCTTGTCCCACACTGGCTG No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063886827 Original CRISPR CAGCCAGTGTGGGACAAGGT TGG (reversed) Intergenic
No off target data available for this crispr