ID: 1063886833

View in Genome Browser
Species Human (GRCh38)
Location 10:10588377-10588399
Sequence AAAGCTGTCACTTACTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063886830_1063886833 -2 Left 1063886830 10:10588356-10588378 CCACACTGGCTGAGAGACCCTAA No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886823_1063886833 24 Left 1063886823 10:10588330-10588352 CCAGTGACCCTAGCTCCAACCTT No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886825_1063886833 16 Left 1063886825 10:10588338-10588360 CCTAGCTCCAACCTTGTCCCACA No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886827_1063886833 9 Left 1063886827 10:10588345-10588367 CCAACCTTGTCCCACACTGGCTG No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886828_1063886833 5 Left 1063886828 10:10588349-10588371 CCTTGTCCCACACTGGCTGAGAG No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886824_1063886833 17 Left 1063886824 10:10588337-10588359 CCCTAGCTCCAACCTTGTCCCAC No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data
1063886829_1063886833 -1 Left 1063886829 10:10588355-10588377 CCCACACTGGCTGAGAGACCCTA No data
Right 1063886833 10:10588377-10588399 AAAGCTGTCACTTACTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063886833 Original CRISPR AAAGCTGTCACTTACTCCTC TGG Intergenic
No off target data available for this crispr