ID: 1063886836

View in Genome Browser
Species Human (GRCh38)
Location 10:10588394-10588416
Sequence CTCTGGGCCTCAGATGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063886830_1063886836 15 Left 1063886830 10:10588356-10588378 CCACACTGGCTGAGAGACCCTAA No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886832_1063886836 -3 Left 1063886832 10:10588374-10588396 CCTAAAGCTGTCACTTACTCCTC No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886828_1063886836 22 Left 1063886828 10:10588349-10588371 CCTTGTCCCACACTGGCTGAGAG No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886827_1063886836 26 Left 1063886827 10:10588345-10588367 CCAACCTTGTCCCACACTGGCTG No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886831_1063886836 -2 Left 1063886831 10:10588373-10588395 CCCTAAAGCTGTCACTTACTCCT No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data
1063886829_1063886836 16 Left 1063886829 10:10588355-10588377 CCCACACTGGCTGAGAGACCCTA No data
Right 1063886836 10:10588394-10588416 CTCTGGGCCTCAGATGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063886836 Original CRISPR CTCTGGGCCTCAGATGAACC TGG Intergenic
No off target data available for this crispr