ID: 1063889436

View in Genome Browser
Species Human (GRCh38)
Location 10:10614580-10614602
Sequence CTCTCTTGCCGAGTTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063889436_1063889440 25 Left 1063889436 10:10614580-10614602 CCACCAGGAACTCGGCAAGAGAG No data
Right 1063889440 10:10614628-10614650 ATAAAAATGAACAAGGTGCTAGG No data
1063889436_1063889439 18 Left 1063889436 10:10614580-10614602 CCACCAGGAACTCGGCAAGAGAG No data
Right 1063889439 10:10614621-10614643 TTCGCAAATAAAAATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063889436 Original CRISPR CTCTCTTGCCGAGTTCCTGG TGG (reversed) Intergenic
No off target data available for this crispr