ID: 1063889439

View in Genome Browser
Species Human (GRCh38)
Location 10:10614621-10614643
Sequence TTCGCAAATAAAAATGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063889434_1063889439 30 Left 1063889434 10:10614568-10614590 CCACAGAGGCTGCCACCAGGAAC No data
Right 1063889439 10:10614621-10614643 TTCGCAAATAAAAATGAACAAGG No data
1063889436_1063889439 18 Left 1063889436 10:10614580-10614602 CCACCAGGAACTCGGCAAGAGAG No data
Right 1063889439 10:10614621-10614643 TTCGCAAATAAAAATGAACAAGG No data
1063889437_1063889439 15 Left 1063889437 10:10614583-10614605 CCAGGAACTCGGCAAGAGAGAAT No data
Right 1063889439 10:10614621-10614643 TTCGCAAATAAAAATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063889439 Original CRISPR TTCGCAAATAAAAATGAACA AGG Intergenic