ID: 1063889440 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:10614628-10614650 |
Sequence | ATAAAAATGAACAAGGTGCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1063889436_1063889440 | 25 | Left | 1063889436 | 10:10614580-10614602 | CCACCAGGAACTCGGCAAGAGAG | No data | ||
Right | 1063889440 | 10:10614628-10614650 | ATAAAAATGAACAAGGTGCTAGG | No data | ||||
1063889437_1063889440 | 22 | Left | 1063889437 | 10:10614583-10614605 | CCAGGAACTCGGCAAGAGAGAAT | No data | ||
Right | 1063889440 | 10:10614628-10614650 | ATAAAAATGAACAAGGTGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1063889440 | Original CRISPR | ATAAAAATGAACAAGGTGCT AGG | Intergenic | ||