ID: 1063903331

View in Genome Browser
Species Human (GRCh38)
Location 10:10758355-10758377
Sequence AATTCCTTATAGAACTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063903331_1063903332 -2 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903332 10:10758376-10758398 TTATCAGCACTACGACTCTTTGG No data
1063903331_1063903338 29 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903338 10:10758407-10758429 GTGGGAAACCCTGGGAGGTCAGG No data
1063903331_1063903335 20 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903335 10:10758398-10758420 GCAGTCTTAGTGGGAAACCCTGG No data
1063903331_1063903333 10 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903333 10:10758388-10758410 CGACTCTTTGGCAGTCTTAGTGG No data
1063903331_1063903336 21 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903336 10:10758399-10758421 CAGTCTTAGTGGGAAACCCTGGG No data
1063903331_1063903334 11 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903334 10:10758389-10758411 GACTCTTTGGCAGTCTTAGTGGG No data
1063903331_1063903337 24 Left 1063903331 10:10758355-10758377 CCTTCAGAGTTCTATAAGGAATT No data
Right 1063903337 10:10758402-10758424 TCTTAGTGGGAAACCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063903331 Original CRISPR AATTCCTTATAGAACTCTGA AGG (reversed) Intergenic
No off target data available for this crispr