ID: 1063903861

View in Genome Browser
Species Human (GRCh38)
Location 10:10763294-10763316
Sequence TCTCATGTGCAGTGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063903861_1063903866 13 Left 1063903861 10:10763294-10763316 CCTCCCACTCACTGCACATGAGA No data
Right 1063903866 10:10763330-10763352 TCGTCGTGAGCCTTGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063903861 Original CRISPR TCTCATGTGCAGTGAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr