ID: 1063903866

View in Genome Browser
Species Human (GRCh38)
Location 10:10763330-10763352
Sequence TCGTCGTGAGCCTTGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063903862_1063903866 10 Left 1063903862 10:10763297-10763319 CCCACTCACTGCACATGAGAGCA No data
Right 1063903866 10:10763330-10763352 TCGTCGTGAGCCTTGTGATGTGG No data
1063903861_1063903866 13 Left 1063903861 10:10763294-10763316 CCTCCCACTCACTGCACATGAGA No data
Right 1063903866 10:10763330-10763352 TCGTCGTGAGCCTTGTGATGTGG No data
1063903863_1063903866 9 Left 1063903863 10:10763298-10763320 CCACTCACTGCACATGAGAGCAA No data
Right 1063903866 10:10763330-10763352 TCGTCGTGAGCCTTGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063903866 Original CRISPR TCGTCGTGAGCCTTGTGATG TGG Intergenic
No off target data available for this crispr