ID: 1063911755

View in Genome Browser
Species Human (GRCh38)
Location 10:10837153-10837175
Sequence TCATTCCCACACGTTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063911748_1063911755 10 Left 1063911748 10:10837120-10837142 CCACCCAAATCTCATTTTGAATT 0: 416
1: 9218
2: 12411
3: 11167
4: 8944
Right 1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG No data
1063911749_1063911755 7 Left 1063911749 10:10837123-10837145 CCCAAATCTCATTTTGAATTATA 0: 55
1: 1436
2: 10400
3: 12118
4: 10691
Right 1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG No data
1063911747_1063911755 11 Left 1063911747 10:10837119-10837141 CCCACCCAAATCTCATTTTGAAT 0: 420
1: 9115
2: 12229
3: 10862
4: 8794
Right 1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG No data
1063911746_1063911755 12 Left 1063911746 10:10837118-10837140 CCCCACCCAAATCTCATTTTGAA 0: 410
1: 9266
2: 12062
3: 10028
4: 7025
Right 1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG No data
1063911750_1063911755 6 Left 1063911750 10:10837124-10837146 CCAAATCTCATTTTGAATTATAG 0: 28
1: 690
2: 5879
3: 9936
4: 11451
Right 1063911755 10:10837153-10837175 TCATTCCCACACGTTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063911755 Original CRISPR TCATTCCCACACGTTGTGGG AGG Intergenic
No off target data available for this crispr