ID: 1063915285

View in Genome Browser
Species Human (GRCh38)
Location 10:10875922-10875944
Sequence GGAATATAAATGCACCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063915285_1063915288 18 Left 1063915285 10:10875922-10875944 CCTTAATGGTGCATTTATATTCC No data
Right 1063915288 10:10875963-10875985 CAAGAGAAAACCTACCTACAGGG No data
1063915285_1063915287 17 Left 1063915285 10:10875922-10875944 CCTTAATGGTGCATTTATATTCC No data
Right 1063915287 10:10875962-10875984 GCAAGAGAAAACCTACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063915285 Original CRISPR GGAATATAAATGCACCATTA AGG (reversed) Intergenic
No off target data available for this crispr