ID: 1063920440

View in Genome Browser
Species Human (GRCh38)
Location 10:10926996-10927018
Sequence AACAGAAGACTGATGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063920440_1063920448 24 Left 1063920440 10:10926996-10927018 CCATTCTTCATCAGTCTTCTGTT No data
Right 1063920448 10:10927043-10927065 CTGCAGGTTGAGGTGCCCCAGGG No data
1063920440_1063920447 23 Left 1063920440 10:10926996-10927018 CCATTCTTCATCAGTCTTCTGTT No data
Right 1063920447 10:10927042-10927064 TCTGCAGGTTGAGGTGCCCCAGG No data
1063920440_1063920444 8 Left 1063920440 10:10926996-10927018 CCATTCTTCATCAGTCTTCTGTT No data
Right 1063920444 10:10927027-10927049 CCAGCTTGACTGGCCTCTGCAGG No data
1063920440_1063920441 -2 Left 1063920440 10:10926996-10927018 CCATTCTTCATCAGTCTTCTGTT No data
Right 1063920441 10:10927017-10927039 TTACTCCTTGCCAGCTTGACTGG No data
1063920440_1063920445 14 Left 1063920440 10:10926996-10927018 CCATTCTTCATCAGTCTTCTGTT No data
Right 1063920445 10:10927033-10927055 TGACTGGCCTCTGCAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063920440 Original CRISPR AACAGAAGACTGATGAAGAA TGG (reversed) Intergenic
No off target data available for this crispr