ID: 1063920574

View in Genome Browser
Species Human (GRCh38)
Location 10:10928187-10928209
Sequence ACATTGTTCTGGAGCTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063920574_1063920579 -6 Left 1063920574 10:10928187-10928209 CCCCCTTAGCTCCAGAACAATGT No data
Right 1063920579 10:10928204-10928226 CAATGTCTCCCTTGCCTGTCCGG No data
1063920574_1063920584 14 Left 1063920574 10:10928187-10928209 CCCCCTTAGCTCCAGAACAATGT No data
Right 1063920584 10:10928224-10928246 CGGTTTATTCCTCCATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063920574 Original CRISPR ACATTGTTCTGGAGCTAAGG GGG (reversed) Intergenic
No off target data available for this crispr