ID: 1063925046

View in Genome Browser
Species Human (GRCh38)
Location 10:10969311-10969333
Sequence ACCCCCAACCTGTGACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063925046_1063925052 30 Left 1063925046 10:10969311-10969333 CCACTAAGTCACAGGTTGGGGGT No data
Right 1063925052 10:10969364-10969386 GATCTCTAAGAACTGTGACTAGG No data
1063925046_1063925050 1 Left 1063925046 10:10969311-10969333 CCACTAAGTCACAGGTTGGGGGT No data
Right 1063925050 10:10969335-10969357 GGCATTAAGGAGAAACATCAGGG No data
1063925046_1063925051 2 Left 1063925046 10:10969311-10969333 CCACTAAGTCACAGGTTGGGGGT No data
Right 1063925051 10:10969336-10969358 GCATTAAGGAGAAACATCAGGGG No data
1063925046_1063925049 0 Left 1063925046 10:10969311-10969333 CCACTAAGTCACAGGTTGGGGGT No data
Right 1063925049 10:10969334-10969356 AGGCATTAAGGAGAAACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063925046 Original CRISPR ACCCCCAACCTGTGACTTAG TGG (reversed) Intergenic
No off target data available for this crispr