ID: 1063925783

View in Genome Browser
Species Human (GRCh38)
Location 10:10975946-10975968
Sequence GGGTGGGTCAATGGAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063925775_1063925783 4 Left 1063925775 10:10975919-10975941 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG No data
1063925776_1063925783 3 Left 1063925776 10:10975920-10975942 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG No data
1063925774_1063925783 12 Left 1063925774 10:10975911-10975933 CCTATAAACCCACTTTCAATTAC No data
Right 1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063925783 Original CRISPR GGGTGGGTCAATGGAAATTG AGG Intergenic
No off target data available for this crispr