ID: 1063927209

View in Genome Browser
Species Human (GRCh38)
Location 10:10992187-10992209
Sequence ATGAATCTACAGATCAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063927208_1063927209 22 Left 1063927208 10:10992142-10992164 CCACAGTGCAGTGGTTTGCAGAA No data
Right 1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063927209 Original CRISPR ATGAATCTACAGATCAACAA TGG Intergenic
No off target data available for this crispr